SCF46912, SCF46912 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF46912
Genbank IDKP278719
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)9
Primer 1SCF46912.forward primer: GAACAATAAAGAGGCTAGAGGA
Primer 2SCF46912.reverse primer: CATAGTTGTAGAGAAGATCGGG
Max Length182
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG04N/A93.8SCF46912View
2Cranberry-Crimson_Queen-2007LG4N/A77.2SCF46912View
3Cranberry-Mullica_Queen-2017LG04N/A101.1SCF46912View
4Cranberry-Crimson_Queen-2017LG04N/A56.2SCF46912View
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A104.59SCF46912View
6Cranberry-CNJ02-1-2007LG4N/A88.29SCF46912View
7Cranberry-Mullica_Queen-2007LG4N/A93.8SCF46912View
8Cranberry-Composite_map-F1LG04N/A77.19SCF46912View
9Cranberry-Crimson_Queen-F1LG04N/A73.26SCF46912View
10Cranberry-Mullica_Queen_1-F1LG04N/A104.8SCF46912View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278719
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF46912.forward primerVaccinium macrocarponprimer
reverse primerSCF46912.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF46912SCF46912Vaccinium macrocarponmarker_locus
SCF46912SCF46912-77.19Vaccinium macrocarponmarker_locus
SCF46912SCF46912-73.26Vaccinium macrocarponmarker_locus
SCF46912SCF46912-104.8Vaccinium macrocarponmarker_locus