SCF4305, SCF4305 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF4305
Genbank IDKP278611
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)13
Primer 1SCF4305.forward primer: AATGAGTGGTTATGTAGGGAGA
Primer 2SCF4305.reverse primer: AGATTGGTGAGATATGAGGAAG
Max Length191
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG7N/A37.92SCF4305ViewN/A
2Blueberry-W85-23-2017LG07N/A34.6SCF4305ViewN/A
3Blueberry-F1#10-2017LG07N/A41.8SCF4305ViewN/A
4Cranberry-Mullica_Queen-2017LG07N/A34SCF4305ViewN/A
5Cranberry-Mullica_Queen-2007LG7N/A39SCF4305ViewN/A
6Cranberry-CNJ02-1-2017LG07N/A33.6SCF4305ViewN/A
7Cranberry-Crimson_Queen-2017LG07N/A34.4SCF4305ViewN/A
8Cranberry-Crimson_Queen-2007LG7N/A36.5SCF4305ViewN/A
9Blueberry-F1#10_x_W85-23-F1-2017LG07N/A41.3SCF4305ViewN/A
10Cranberry-Composite_map-F1LG07N/A59SCF4305ViewN/A
11Cranberry-Crimson_Queen-F1LG07N/A55.41SCF4305ViewN/A
12Cranberry-Mullica_Queen_1-F1LG07N/A70.36SCF4305ViewN/A
13Cranberry-BB/CQ-F1LG03N/A62.67SCF4305ViewN/A
14Cranberry-BB/CQ-F1LG03N/A64.59SCF4305ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278611
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF4305.forward primerVaccinium macrocarponprimer
reverse primerSCF4305.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF4305SCF4305Vaccinium macrocarponmarker_locus
SCF4305SCF4305-59Vaccinium macrocarponmarker_locus
SCF4305SCF4305-55.41Vaccinium macrocarponmarker_locus
SCF4305SCF4305-70.36Vaccinium macrocarponmarker_locus
SCF4305SCF4305-62.673Vaccinium macrocarponmarker_locus
SCF4305SCF4305-64.594Vaccinium macrocarponmarker_locus