scf511, scf511 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf511
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf511.forward primer: CTCCCTCCTTCCGATGAAGT
Primer 2	scf511.reverse primer: CACAAAGTTCCACGCAGAAA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vcev1_p0.Chr08	supercontig	Vcev1_p0.Chr08:55909794..55909968 .
VaccDscaff30	supercontig	VaccDscaff30:2326679..2326876 .
scaffold00338	supercontig	scaffold00338:57236..57411 .
chr8_H1	supercontig	chr8_H1:41802285..41802472 .
Vmac_chr03	supercontig	Vmac_chr03:36871255..36871454 .
chr3	supercontig	chr3:35836832..35837042 .
Chr08	supercontig	Chr08:35718244..35718441 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG3	N/A	112.76	scf511	View
2	Cranberry-CNJ02-1-2007	LG3	N/A	100.59	scf511	View
3	Cranberry-Crimson_Queen-2007	LG3	N/A	90.6	scf511	View
4	Cranberry-Mullica_Queen-2007	LG3	N/A	110.2	scf511	View
5	Cranberry-Unifiedmap2013	LG7b	N/A	1.2	scf511	View
6	Cranberry-Crimson_Queen-F1	LG03	N/A	0	scf511	View
7	Cranberry-CNJ02-1-2017	LG03	N/A	94.4	scf511	View
8	Cranberry-Crimson_Queen-2017	LG03	N/A	85.5	scf511	View
9	Cranberry-Mullica_Queen-2017	LG03	N/A	103.3	scf511	View
10	Cranberry-[BG//BL/BN]95-F1	LG03	N/A	4.56	scf511	View
11	Cranberry-Composite_map-F1	LG03	N/A	4.56	scf511	View
12	Cranberry-GH1/35-F1	LG03	N/A	3.13	scf511	View
13	Cranberry-Mullica_Queen_1-F1	LG03	N/A	5.36	scf511	View
14	Cranberry-BB/CQ-F1	LG07	N/A	97.06	scf511	View
15	Cranberry-BB/CQ-F1	LG07	N/A	76.96	scf511	View