SCF43220, SCF43220 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDKP278712
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 1SCF43220.forward primer: CTTGTCGAGCATCCTATATTTC
Primer 2SCF43220.reverse primer: AAAAGTCATGGGAAGGTGTT
Max Length159
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG1N/A97.81SCF43220ViewN/A
External references for this genetic_marker

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF43220.forward primerVaccinium macrocarponprimer
reverse primerSCF43220.reverse primerVaccinium macrocarponprimer

This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit length:width ratioqFWLR.GRYG.LG01.14Vaccinium macrocarponQTL

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF43220SCF43220Vaccinium macrocarponmarker_locus
SCF43220SCF43220-34.75Vaccinium macrocarponmarker_locus
SCF43220SCF43220-30.57Vaccinium macrocarponmarker_locus
SCF43220SCF43220-11.32Vaccinium macrocarponmarker_locus
SCF43220SCF43220-13.11Vaccinium macrocarponmarker_locus
SCF43220SCF43220-40.81Vaccinium macrocarponmarker_locus
SCF43220SCF43220-67.742Vaccinium macrocarponmarker_locus