SCF43220, SCF43220 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF43220
Genbank IDKP278712
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)14
Primer 1SCF43220.forward primer: CTTGTCGAGCATCCTATATTTC
Primer 2SCF43220.reverse primer: AAAAGTCATGGGAAGGTGTT
Max Length159
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Crimson_Queen-2007LG1N/A71.2SCF43220ViewN/A
2Cranberry-Mullica_Queen-2017LG01N/A85.8SCF43220ViewN/A
3Cranberry-Crimson_Queen-2017LG01N/A64.7SCF43220ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A79.54SCF43220ViewN/A
5Cranberry-Mullica_Queen-2007LG1N/A89.9SCF43220ViewN/A
6Cranberry-CNJ02-1-2017LG01N/A74.3SCF43220ViewN/A
7Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG1N/A97.81SCF43220ViewN/A
8Cranberry-[BG//BL/BN]95-F1LG01N/A34.75SCF43220ViewN/A
9Cranberry-Composite_map-F1LG01N/A30.57SCF43220ViewN/A
10Cranberry-Crimson_Queen-F1LG01N/A11.32SCF43220ViewN/A
11Cranberry-Mullica_Queen_1-F1LG01N/A13.11SCF43220ViewN/A
12Cranberry-BB/CQ-F1LG09N/A40.81SCF43220ViewN/A
13Cranberry-BB/CQ-F1LG09N/A67.74SCF43220ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278712
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF43220.forward primerVaccinium macrocarponprimer
reverse primerSCF43220.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit length:width ratioqFWLR.GRYG.LG01.14Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF43220SCF43220Vaccinium macrocarponmarker_locus
SCF43220SCF43220-34.75Vaccinium macrocarponmarker_locus
SCF43220SCF43220-30.57Vaccinium macrocarponmarker_locus
SCF43220SCF43220-11.32Vaccinium macrocarponmarker_locus
SCF43220SCF43220-13.11Vaccinium macrocarponmarker_locus
SCF43220SCF43220-40.81Vaccinium macrocarponmarker_locus
SCF43220SCF43220-67.742Vaccinium macrocarponmarker_locus