SCF43220, SCF43220 (genetic_marker) Vaccinium macrocarpon

Marker Overview


Name	SCF43220
Genbank ID	KP278712
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)14
Primer 1	SCF43220.forward primer: CTTGTCGAGCATCCTATATTTC
Primer 2	SCF43220.reverse primer: AAAAGTCATGGGAAGGTGTT
Max Length	159
Publication	[view all]

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer	CMap
1	Cranberry-Crimson_Queen-2007	LG1	N/A	71.2	SCF43220	View	N/A
2	Cranberry-Mullica_Queen-2017	LG01	N/A	85.8	SCF43220	View	N/A
3	Cranberry-Crimson_Queen-2017	LG01	N/A	64.7	SCF43220	View	N/A
4	Cranberry-CNJ02-1-2007	LG1	N/A	79.54	SCF43220	View	N/A
5	Cranberry-Mullica_Queen-2007	LG1	N/A	89.9	SCF43220	View	N/A
6	Cranberry-CNJ02-1-2017	LG01	N/A	74.3	SCF43220	View	N/A
7	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG1	N/A	97.81	SCF43220	View	N/A
8	Cranberry-[BG//BL/BN]95-F1	LG01	N/A	34.75	SCF43220	View	N/A
9	Cranberry-Composite_map-F1	LG01	N/A	30.57	SCF43220	View	N/A
10	Cranberry-Crimson_Queen-F1	LG01	N/A	11.32	SCF43220	View	N/A
11	Cranberry-Mullica_Queen_1-F1	LG01	N/A	13.11	SCF43220	View	N/A
12	Cranberry-BB/CQ-F1	LG09	N/A	40.81	SCF43220	View	N/A
13	Cranberry-BB/CQ-F1	LG09	N/A	67.74	SCF43220	View	N/A

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278712

Relationships

This genetic_marker is adjacent to the following primer feature(s):


Feature Name	Unique Name	Species	Type
forward primer	SCF43220.forward primer	Vaccinium macrocarpon	primer
reverse primer	SCF43220.reverse primer	Vaccinium macrocarpon	primer

This genetic_marker is located in the following QTL feature(s):


Feature Name	Unique Name	Species	Type
Fruit length:width ratio	qFWLR.GRYG.LG01.14	Vaccinium macrocarpon	QTL

The following marker_locus feature(s) are an instance of this genetic_marker:


Feature Name	Unique Name	Species	Type
SCF43220	SCF43220	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-34.75	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-30.57	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-11.32	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-13.11	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-40.81	Vaccinium macrocarpon	marker_locus
SCF43220	SCF43220-67.742	Vaccinium macrocarpon	marker_locus