SCF4386, SCF4386 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF4386
Genbank IDKP278612
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTC)9
Primer 1SCF4386.forward primer: GTTACTCATTTCTTTGCTGAGG
Primer 2SCF4386.reverse primer: CCTCTTAGTGTTGGAGTTTCAT
Max Length203
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A105.1SCF4386ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A97.2SCF4386ViewN/A
3Cranberry-Crimson_Queen-2007LG1N/A100.6SCF4386ViewN/A
4Cranberry-GH1/35-F1LG01N/A0SCF4386ViewN/A
5Cranberry-CNJ02-1-2007LG1N/A113.64SCF4386ViewN/A
6Cranberry-Composite_map-F1LG01N/A2.9SCF4386ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278612
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF4386.forward primerVaccinium macrocarponprimer
reverse primerSCF4386.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF4386SCF4386Vaccinium macrocarponmarker_locus
SCF4386SCF4386-2.9Vaccinium macrocarponmarker_locus