SCF49598, SCF49598 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF49598
Genbank IDKP278723
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TCT)8
Primer 1SCF49598.forward primer: ATGAGGTTTTCCAACACAAC
Primer 2SCF49598.reverse primer: TCAGAGGGAAGTACATGAGAAT
Max Length261
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG04N/A84.4SCF49598View
2Cranberry-Crimson_Queen-2017LG04N/A48.4SCF49598View
3Cranberry-Mullica_Queen-2017LG04N/A89.5SCF49598View
4Cranberry-Crimson_Queen-2007LG4N/A73.7SCF49598View
5Cranberry-CNJ02-1-2007LG4N/A83.7SCF49598View
6Cranberry-Mullica_Queen-2007LG4N/A87SCF49598View
7Cranberry-Composite_map-F1LG04N/A70.59SCF49598View
8Cranberry-Crimson_Queen-F1LG04N/A72.07SCF49598View
9Cranberry-GH1/35-F1LG04N/A65.73SCF49598View
10Cranberry-Mullica_Queen_1-F1LG04N/A98.2SCF49598View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278723
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF49598.forward primerVaccinium macrocarponprimer
reverse primerSCF49598.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Fruit projected areaqFPA.GRYG.LG04.16Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF49598SCF49598Vaccinium macrocarponmarker_locus
SCF49598SCF49598-70.59Vaccinium macrocarponmarker_locus
SCF49598SCF49598-72.07Vaccinium macrocarponmarker_locus
SCF49598SCF49598-65.73Vaccinium macrocarponmarker_locus
SCF49598SCF49598-98.2Vaccinium macrocarponmarker_locus