scf5304, scf5304 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf5304
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf5304.forward primer: TACACAGCTTCATTCGGCAA
Primer 2scf5304.reverse primer: AAGCTCACCCAATCGAAAGA
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG03N/A28.9scf5304View
2Cranberry-Unifiedmap2013LG7aN/A28.9scf5304View
3Cranberry-CNJ02-1-2007LG3N/A35.48scf5304View
4Cranberry-Mullica_Queen-2007LG3N/A42.1scf5304View
5Cranberry-Crimson_Queen-2007LG3N/A30.1scf5304View
6Cranberry-Crimson_Queen-2017LG03N/A26.2scf5304View
7Cranberry-Mullica_Queen-2017LG03N/A31.9scf5304View
8Cranberry-Composite_map-F1LG03N/A56.18scf5304View
9Cranberry-Crimson_Queen-F1LG03N/A56.24scf5304View
10Cranberry-Mullica_Queen_1-F1LG03N/A73.31scf5304View
11Cranberry-Mullica_Queen_2-F1LG03N/A54.16scf5304View
12Cranberry-BB/CQ-F1LG07N/A44.78scf5304View
13Cranberry-BB/CQ-F1LG07N/A32.02scf5304View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf5304.forward primerVaccinium macrocarponprimer
reverse primerscf5304.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Total anthocyanin contentqTAC.CNJ02-1.LG03Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf5304scf5304Vaccinium macrocarponmarker_locus
scf5304scf5304-56.18Vaccinium macrocarponmarker_locus
scf5304scf5304-56.24Vaccinium macrocarponmarker_locus
scf5304scf5304-73.31Vaccinium macrocarponmarker_locus
scf5304scf5304-54.16Vaccinium macrocarponmarker_locus
scf5304scf5304-44.781Vaccinium macrocarponmarker_locus
scf5304scf5304-32.019Vaccinium macrocarponmarker_locus