SCF53282, SCF53282 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF53282
Genbank IDKP278726
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)11
Primer 1SCF53282.forward primer: GACAATCACATACCCATAACAG
Primer 2SCF53282.reverse primer: CCACTCTTTCCCTCTATCG
Max Length234
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG4N/A111.3SCF53282View
2Cranberry-CNJ02-1-2007LG4N/A95.03SCF53282View
3Cranberry-CNJ02-1-2017LG04N/A95.4SCF53282View
4Cranberry-Mullica_Queen-2007LG4N/A98.9SCF53282View
5Cranberry-Mullica_Queen-2017LG04N/A103.8SCF53282View
6Cranberry-Crimson_Queen-2007LG4N/A79SCF53282View
7Cranberry-Crimson_Queen-2017LG04N/A56.2SCF53282View
8Cranberry-[BG//BL/BN]95-F1LG04N/A85.18SCF53282View
9Cranberry-Composite_map-F1LG04N/A83.32SCF53282View
10Cranberry-Crimson_Queen-F1LG04N/A79.22SCF53282View
11Cranberry-Mullica_Queen_1-F1LG04N/A112.12SCF53282View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278726
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF53282.forward primerVaccinium macrocarponprimer
reverse primerSCF53282.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF53282SCF53282Vaccinium macrocarponmarker_locus
SCF53282SCF53282-85.18Vaccinium macrocarponmarker_locus
SCF53282SCF53282-83.32Vaccinium macrocarponmarker_locus
SCF53282SCF53282-79.22Vaccinium macrocarponmarker_locus
SCF53282SCF53282-112.12Vaccinium macrocarponmarker_locus