scf55c, scf55c (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf55c
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf55c.forward primer: AGCCATTGATCTCCAACCAC
Primer 2scf55c.reverse primer: GCGTTTCAATCTTTGGCAAT
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG9N/A104.36scf55cView
2Cranberry-CNJ02-1-2007LG9N/A87.28scf55cView
3Cranberry-Crimson_Queen-2007LG9N/A79.4scf55cView
4Cranberry-Mullica_Queen-2007LG9N/A103.2scf55cView
5Cranberry-Unifiedmap2013LG1N/A5.5scf55cView
6Cranberry-Crimson_Queen-F1LG09N/A0scf55cView
7Cranberry-Stevens-F1LG09N/A0scf55cView
8Cranberry-CNJ02-1-2017LG09N/A80.7scf55cView
9Cranberry-Crimson_Queen-2017LG09N/A70.7scf55cView
10Cranberry-Mullica_Queen-2017LG09N/A93.1scf55cView
11Cranberry-Composite_map-F1LG09N/A4.55scf55cView
12Cranberry-GH1/35-F1LG09N/A4.55scf55cView
13Cranberry-Mullica_Queen_1-F1LG09N/A6.58scf55cView
14Cranberry-Mullica_Queen_2-F1LG09N/A4.49scf55cView
15Cranberry-BB/CQ-F1LG01N/A8.67scf55cView
16Cranberry-BB/CQ-F1LG01N/A3.59scf55cView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf55c.forward primerVaccinium macrocarponprimer
reverse primerscf55c.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf55cscf55cVaccinium macrocarponmarker_locus
scf55cscf55c-4.55Vaccinium macrocarponmarker_locus
scf55cscf55c-6.58Vaccinium macrocarponmarker_locus
scf55cscf55c-4.49Vaccinium macrocarponmarker_locus
scf55cscf55c-8.667Vaccinium macrocarponmarker_locus
scf55cscf55c-3.589Vaccinium macrocarponmarker_locus