scf439, scf439 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf439
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf439.forward primer: TTGTGTGATCCGCTACTTGG
Primer 2scf439.reverse primer: ATCGTTCAAAACGAAGGGTG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG09N/A33.2scf439ViewN/A
2Cranberry-Unifiedmap2013LG1N/A76.8scf439ViewN/A
3Cranberry-Crimson_Queen-2017LG09N/A27.4scf439ViewN/A
4Cranberry-Crimson_Queen-2007LG9N/A34.4scf439ViewN/A
5Cranberry-CNJ02-1-2007LG9N/A36.58scf439ViewN/A
6Cranberry-Composite_map-F1LG09N/A62.74scf439ViewN/A
7Cranberry-Crimson_Queen-F1LG09N/A44.74scf439ViewN/A
8Cranberry-BB/CQ-F1LG01N/A64.21scf439ViewN/A
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf439.forward primerVaccinium macrocarponprimer
reverse primerscf439.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf439scf439Vaccinium macrocarponmarker_locus
scf439scf439-62.74Vaccinium macrocarponmarker_locus
scf439scf439-44.74Vaccinium macrocarponmarker_locus
scf439scf439-64.208Vaccinium macrocarponmarker_locus