scf439, scf439 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf439
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf439.forward primer: TTGTGTGATCCGCTACTTGG
Primer 2	scf439.reverse primer: ATCGTTCAAAACGAAGGGTG
Publication	[view all]

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG9	N/A	36.58	scf439	View
2	Cranberry-Crimson_Queen-2007	LG9	N/A	34.4	scf439	View
3	Cranberry-Unifiedmap2013	LG1	N/A	76.8	scf439	View
4	Cranberry-CNJ02-1-2017	LG09	N/A	33.2	scf439	View
5	Cranberry-Crimson_Queen-2017	LG09	N/A	27.4	scf439	View
6	Cranberry-Composite_map-F1	LG09	N/A	62.74	scf439	View
7	Cranberry-Crimson_Queen-F1	LG09	N/A	44.74	scf439	View
8	Cranberry-BB/CQ-F1	LG01	N/A	64.21	scf439	View