SCF59035, SCF59035 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF59035
Genbank IDKP278739
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)16
Primer 1SCF59035.forward primer: AGATTTTGAACGATGTCTGC
Primer 2SCF59035.reverse primer: GATCTATCGCTTATCCAGTACG
Max Length336
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2017LG05N/A16.9SCF59035View
2Cranberry-CNJ02-1-2017LG05N/A12.5SCF59035View
3Blueberry-F1#10_x_W85-23-F1-2017LG05N/A15.3SCF59035View
4Cranberry-CNJ02-1-2007LG5N/A13.38SCF59035View
5Cranberry-Mullica_Queen-2007LG5N/A18.8SCF59035View
6Blueberry-F1#10-2017LG05N/A17SCF59035View
7Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG5N/A49.81SCF59035View
8Cranberry-Crimson_Queen-2007LG5N/A9.7SCF59035View
9Cranberry-Crimson_Queen-2017LG05N/A9.8SCF59035View
10Cranberry-[BG//BL/BN]95-F1LG05N/A17.97SCF59035View
11Cranberry-Composite_map-F1LG05N/A15.21SCF59035View
12Cranberry-Crimson_Queen-F1LG05N/A6.55SCF59035View
13Cranberry-GH1/35-F1LG05N/A13.08SCF59035View
14Cranberry-Mullica_Queen_1-F1LG05N/A14.92SCF59035View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278739
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF59035.forward primerVaccinium macrocarponprimer
reverse primerSCF59035.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF59035SCF59035Vaccinium macrocarponmarker_locus
SCF59035SCF59035-17.97Vaccinium macrocarponmarker_locus
SCF59035SCF59035-15.21Vaccinium macrocarponmarker_locus
SCF59035SCF59035-6.55Vaccinium macrocarponmarker_locus
SCF59035SCF59035-13.08Vaccinium macrocarponmarker_locus
SCF59035SCF59035-14.92Vaccinium macrocarponmarker_locus