SCF59248, SCF59248 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF59248
Genbank IDKP278740
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TTA)7
Primer 1SCF59248.forward primer: TAGTTGAAAATGGAGAGAGAGC
Primer 2SCF59248.reverse primer: TTAGATGCCCAACACTACATC
Max Length204
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A52.75SCF59248View
2Cranberry-CNJ02-1-2017LG01N/A49.9SCF59248View
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG1N/A59.18SCF59248View
4Cranberry-Crimson_Queen-2007LG1N/A45.8SCF59248View
5Cranberry-Crimson_Queen-2017LG01N/A43.9SCF59248View
6Cranberry-Composite_map-F1LG01N/A62.99SCF59248View
7Cranberry-Crimson_Queen-F1LG01N/A35.75SCF59248View
8Cranberry-BB/CQ-F1LG09N/A40.16SCF59248View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278740
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF59248.forward primerVaccinium macrocarponprimer
reverse primerSCF59248.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF59248SCF59248Vaccinium macrocarponmarker_locus
SCF59248SCF59248-62.99Vaccinium macrocarponmarker_locus
SCF59248SCF59248-35.75Vaccinium macrocarponmarker_locus
SCF59248SCF59248-40.158Vaccinium macrocarponmarker_locus