SCF59739, SCF59739 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF59739
Genbank IDKP278741
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)11
Primer 1SCF59739.forward primer: GTATGACTGTACCAAACAAACC
Primer 2SCF59739.reverse primer: CAGCTTTCCCTTCTAAATGA
Max Length350
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG12N/A49.8SCF59739View
2Cranberry-CNJ02-1-2017LG12N/A47.6SCF59739View
3Cranberry-Mullica_Queen-2007LG12N/A59.7SCF59739View
4Cranberry-Crimson_Queen-2017LG12N/A38.2SCF59739View
5Cranberry-Mullica_Queen-2017LG12N/A56.8SCF59739View
6Cranberry-CNJ02-1-2007LG12N/A53.07SCF59739View
7Cranberry-Composite_map-F1LG12N/A38.3SCF59739View
8Cranberry-Crimson_Queen-F1LG12N/A17.35SCF59739View
9Cranberry-Mullica_Queen_1-F1LG12N/A39.97SCF59739View
10Cranberry-Mullica_Queen_2-F1LG12N/A22.88SCF59739View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278741
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF59739.forward primerVaccinium macrocarponprimer
reverse primerSCF59739.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF59739SCF59739Vaccinium macrocarponmarker_locus
SCF59739SCF59739-38.3Vaccinium macrocarponmarker_locus
SCF59739SCF59739-17.35Vaccinium macrocarponmarker_locus
SCF59739SCF59739-39.97Vaccinium macrocarponmarker_locus
SCF59739SCF59739-22.88Vaccinium macrocarponmarker_locus