scf6213, scf6213 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf6213
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf6213.forward primer: GCTCGCTCTCGCATATTTTC
Primer 2	scf6213.reverse primer: CCTAGCCCGTTCATCATTGT
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:33938163..33938467 .
chr12	supercontig	chr12:32686074..32686380 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG12	N/A	11.17	scf6213	View
2	Cranberry-Crimson_Queen-2007	LG12	N/A	10.8	scf6213	View
3	Cranberry-Mullica_Queen-2007	LG12	N/A	14.7	scf6213	View
4	Cranberry-Unifiedmap2013	LG6	N/A	36.6	scf6213	View
5	Cranberry-CNJ02-1-2017	LG12	N/A	2.6	scf6213	View
6	Cranberry-Crimson_Queen-2017	LG12	N/A	0.9	scf6213	View
7	Cranberry-Mullica_Queen-2017	LG12	N/A	5	scf6213	View
8	Cranberry-Composite_map-F1	LG12	N/A	77.11	scf6213	View
9	Cranberry-Crimson_Queen-F1	LG12	N/A	56.74	scf6213	View
10	Cranberry-Mullica_Queen_1-F1	LG12	N/A	89.64	scf6213	View
11	Cranberry-Mullica_Queen_2-F1	LG12	N/A	64.76	scf6213	View
12	Cranberry-Stevens-F1	LG12	N/A	61.69	scf6213	View
13	Cranberry-BB/CQ-F1	LG06	N/A	11.51	scf6213	View
14	Cranberry-BB/CQ-F1	LG06	N/A	11.1	scf6213	View