scf44a, scf44a (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf44a
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ag)19
Primer 1scf44a.forward primer: ACAAAACCACTGGCGAAAAC
Primer 2scf44a.reverse primer: GAGTGACCAGGGGAGATGAA
Max Length259
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG06N/A0scf44aView
2Cranberry-Unifiedmap2013LG5N/A105scf44aView
3Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG6N/A119.01scf44aView
4Cranberry-Mullica_Queen-2017LG06N/A0scf44aView
5Blueberry-F1#10_x_W85-23-F1-2017LG06N/A8.2scf44aView
6Blueberry-W85-23-2017LG06N/A0scf44aView
7Cranberry-Crimson_Queen-2017LG06N/A0scf44aView
8Cranberry-CNJ02-1-2007LG6N/A4.81scf44aView
9Blueberry-F1#10-2017LG06N/A12.2scf44aView
10Cranberry-Mullica_Queen-2007LG6N/A7.3scf44aView
11Cranberry-Crimson_Queen-2007LG6N/A3.4scf44aView
12Cranberry-Composite_map-F1LG06N/A87.4scf44aView
13Cranberry-Crimson_Queen-F1LG06N/A78.87scf44aView
14Cranberry-Mullica_Queen_1-F1LG06N/A105.39scf44aView
15Cranberry-BB/CQ-F1LG05N/A84.77scf44aView
16Cranberry-BB/CQ-F1LG05N/A6.72scf44aView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf44a.forward primerVaccinium macrocarponprimer
reverse primerscf44a.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf44ascf44aVaccinium macrocarponmarker_locus
scf44ascf44a-87.4Vaccinium macrocarponmarker_locus
scf44ascf44a-78.87Vaccinium macrocarponmarker_locus
scf44ascf44a-105.39Vaccinium macrocarponmarker_locus
scf44ascf44a-84.77Vaccinium macrocarponmarker_locus
scf44ascf44a-6.719Vaccinium macrocarponmarker_locus