scf6355, scf6355 (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf6355
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf6355.forward primer: ACAATGTTGTCATTCCGACG
Primer 2scf6355.reverse primer: CTAGACTCGTCCAAAAGCCC
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG12N/A57.3scf6355View
2Cranberry-CNJ02-1-2017LG12N/A62.8scf6355View
3Cranberry-Mullica_Queen-2017LG12N/A67.4scf6355View
4Cranberry-Unifiedmap2013LG12N/A5.7scf6355View
5Cranberry-Mullica_Queen-2007LG12N/A88.8scf6355View
6Cranberry-CNJ02-1-2007LG12N/A73.72scf6355View
7Cranberry-Crimson_Queen-2007LG12N/A65.6scf6355View
8Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG12N/A7.79scf6355View
9Cranberry-[BG//BL/BN]95-F1LG12N/A7.34scf6355View
10Cranberry-Composite_map-F1LG12N/A8.25scf6355View
11Cranberry-Crimson_Queen-F1LG12N/A1.79scf6355View
12Cranberry-GH1/35-F1LG12N/A8.81scf6355View
13Cranberry-Mullica_Queen_1-F1LG12N/A4.77scf6355View
14Cranberry-BB/CQ-F1LG06N/A69.47scf6355View
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf6355.forward primerVaccinium macrocarponprimer
reverse primerscf6355.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf6355scf6355Vaccinium macrocarponmarker_locus
scf6355scf6355-7.34Vaccinium macrocarponmarker_locus
scf6355scf6355-8.25Vaccinium macrocarponmarker_locus
scf6355scf6355-1.79Vaccinium macrocarponmarker_locus
scf6355scf6355-8.81Vaccinium macrocarponmarker_locus
scf6355scf6355-4.77Vaccinium macrocarponmarker_locus
scf6355scf6355-69.467Vaccinium macrocarponmarker_locus