SCF63953, SCF63953 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF63953
Genbank ID	KP279029
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)9
Primer 1	SCF63953.forward primer: GTTGGTGTGGTTCTCATTATC
Primer 2	SCF63953.reverse primer: GTGAGTGCTGATAGGGTAGAGT
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279029

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr05	supercontig	Vmac_chr05:5923627..5923958 .
chr5	supercontig	chr5:26649297..26649628 .
Chr09	supercontig	Chr09:31299444..31299768 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.