SCF64632, SCF64632 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF64632
Genbank IDKP278746
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)12
Primer 1SCF64632.forward primer: ACCTCCTAAAACACAACCCTA
Primer 2SCF64632.reverse primer: CTGAGTAATCTTCGATGTGAGA
Max Length175
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG08N/A33.8SCF64632View
2Cranberry-Mullica_Queen-2017LG08N/A34.7SCF64632View
3Cranberry-Crimson_Queen-2007LG8N/A33.8SCF64632View
4Cranberry-CNJ02-1-2007LG8N/A35.62SCF64632View
5Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG8N/A24.04SCF64632View
6Cranberry-Mullica_Queen-2007LG8N/A37.1SCF64632View
7Cranberry-Crimson_Queen-2017LG08N/A30.4SCF64632View
8Cranberry-[BG//BL/BN]95-F1LG08N/A58.33SCF64632View
9Cranberry-Composite_map-F1LG08N/A52.93SCF64632View
10Cranberry-Crimson_Queen-F1LG08N/A38.79SCF64632View
11Cranberry-Mullica_Queen_1-F1LG08N/A68.42SCF64632View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278746
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF64632.forward primerVaccinium macrocarponprimer
reverse primerSCF64632.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF64632SCF64632Vaccinium macrocarponmarker_locus
SCF64632SCF64632-58.33Vaccinium macrocarponmarker_locus
SCF64632SCF64632-52.93Vaccinium macrocarponmarker_locus
SCF64632SCF64632-38.79Vaccinium macrocarponmarker_locus
SCF64632SCF64632-68.42Vaccinium macrocarponmarker_locus