SCF662, SCF662 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF662
Genbank ID	KP278956
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(GA)10
Primer 1	SCF662.forward primer: TTGGACAATCTTACCCATAGAC
Primer 2	SCF662.reverse primer: CTTGGCGTGCATAGAATAA
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278956

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr10	supercontig	Vmac_chr10:13195035..13195209 .
chr10	supercontig	chr10:12228818..12228992 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.