SCF69981, SCF69981 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF69981
Genbank IDKP278752
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)9
Primer 1SCF69981.forward primer: AGCGTTACCACCGAATATAA
Primer 2SCF69981.reverse primer: CGAGATATAGTTAAAAGGACGG
Max Length244
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2017LG01N/A7.4SCF69981ViewN/A
2Cranberry-Crimson_Queen-2017LG01N/A4.6SCF69981ViewN/A
3Cranberry-Crimson_Queen-2007LG1N/A5.2SCF69981ViewN/A
4Cranberry-Mullica_Queen-2007LG1N/A9.1SCF69981ViewN/A
5Cranberry-Mullica_Queen-2017LG01N/A8.3SCF69981ViewN/A
6Cranberry-CNJ02-1-2007LG1N/A8.06SCF69981ViewN/A
7Cranberry-Composite_map-F1LG01N/A106.91SCF69981ViewN/A
8Cranberry-Crimson_Queen-F1LG01N/A74.53SCF69981ViewN/A
9Cranberry-Mullica_Queen_1-F1LG01N/A97.42SCF69981ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278752
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF69981.forward primerVaccinium macrocarponprimer
reverse primerSCF69981.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF69981SCF69981Vaccinium macrocarponmarker_locus
SCF69981SCF69981-106.91Vaccinium macrocarponmarker_locus
SCF69981SCF69981-74.53Vaccinium macrocarponmarker_locus
SCF69981SCF69981-97.42Vaccinium macrocarponmarker_locus