SCF69981, SCF69981 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF69981
Genbank IDKP278752
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)9
Primer 1SCF69981.forward primer: AGCGTTACCACCGAATATAA
Primer 2SCF69981.reverse primer: CGAGATATAGTTAAAAGGACGG
Max Length244
Publication[view all]
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278752
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG1N/A8.06SCF69981View
2Cranberry-Crimson_Queen-2007LG1N/A5.2SCF69981View
3Cranberry-Mullica_Queen-2007LG1N/A9.1SCF69981View
4Cranberry-CNJ02-1-2017LG01N/A7.4SCF69981View
5Cranberry-Crimson_Queen-2017LG01N/A4.6SCF69981View
6Cranberry-Mullica_Queen-2017LG01N/A8.3SCF69981View
7Cranberry-Composite_map-F1LG01N/A106.91SCF69981View
8Cranberry-Crimson_Queen-F1LG01N/A74.53SCF69981View
9Cranberry-Mullica_Queen_1-F1LG01N/A97.42SCF69981View