SCF68870, SCF68870 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF68870
Genbank IDKP278750
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)11
Primer 1SCF68870.forward primer: GTGAATTGTTGCAGAGTACCTA
Primer 2SCF68870.reverse primer: TGAGTTGAGTTCATATAGCTGG
Max Length168
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Blueberry-F1#10-2017LG01N/A0SCF68870ViewN/A
2Cranberry-Mullica_Queen-2017LG01N/A0SCF68870ViewN/A
3Cranberry-CNJ02-1-2017LG01N/A0SCF68870ViewN/A
4Cranberry-CNJ02-1-2007LG1N/A0SCF68870ViewN/A
5Blueberry-F1#10_x_W85-23-F1-2017LG01N/A0SCF68870ViewN/A
6Cranberry-Mullica_Queen-2007LG1N/A0.8SCF68870ViewN/A
7Cranberry-Composite_map-F1LG01N/A115.88SCF68870ViewN/A
8Cranberry-Mullica_Queen_1-F1LG01N/A106.98SCF68870ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278750
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF68870.forward primerVaccinium macrocarponprimer
reverse primerSCF68870.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF68870SCF68870Vaccinium macrocarponmarker_locus
SCF68870SCF68870-115.88Vaccinium macrocarponmarker_locus
SCF68870SCF68870-106.98Vaccinium macrocarponmarker_locus