scf6i, scf6i (genetic_marker) Vaccinium macrocarpon

Marker Overview
Namescf6i
Genbank IDN/A
TypeSSR
SpeciesVaccinium macrocarpon
Primer 1scf6i.forward primer: TTGTTTGGTGCTACGAGTGC
Primer 2scf6i.reverse primer: GGCCTGAACTTTCCTGACTG
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG9N/A56.94scf6iView
2Cranberry-Crimson_Queen-2007LG9N/A51.8scf6iView
3Cranberry-Mullica_Queen-2007LG9N/A70.4scf6iView
4Cranberry-Unifiedmap2013LG1N/A40.7scf6iView
5Cranberry-CNJ02-1-2017LG09N/A50.5scf6iView
6Cranberry-Crimson_Queen-2017LG09N/A41.8scf6iView
7Cranberry-Mullica_Queen-2017LG09N/A60.6scf6iView
8Cranberry-Composite_map-F1LG09N/A38.06scf6iView
9Cranberry-Crimson_Queen-F1LG09N/A27.47scf6iView
10Cranberry-Mullica_Queen_1-F1LG09N/A38.77scf6iView
11Cranberry-Mullica_Queen_2-F1LG09N/A41.61scf6iView
12Cranberry-Stevens-F1LG09N/A25.72scf6iView
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf6i.forward primerVaccinium macrocarponprimer
reverse primerscf6i.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf6iscf6iVaccinium macrocarponmarker_locus
scf6iscf6i-38.06Vaccinium macrocarponmarker_locus
scf6iscf6i-27.47Vaccinium macrocarponmarker_locus
scf6iscf6i-38.77Vaccinium macrocarponmarker_locus
scf6iscf6i-41.61Vaccinium macrocarponmarker_locus
scf6iscf6i-25.72Vaccinium macrocarponmarker_locus