scf6i, scf6i (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf6i
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf6i.forward primer: TTGTTTGGTGCTACGAGTGC
Primer 2	scf6i.reverse primer: GGCCTGAACTTTCCTGACTG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr09	supercontig	Vmac_chr09:29420972..29421122 .
chr9	supercontig	chr9:12049496..12049645 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG9	N/A	56.94	scf6i	View
2	Cranberry-Crimson_Queen-2007	LG9	N/A	51.8	scf6i	View
3	Cranberry-Mullica_Queen-2007	LG9	N/A	70.4	scf6i	View
4	Cranberry-Unifiedmap2013	LG1	N/A	40.7	scf6i	View
5	Cranberry-CNJ02-1-2017	LG09	N/A	50.5	scf6i	View
6	Cranberry-Crimson_Queen-2017	LG09	N/A	41.8	scf6i	View
7	Cranberry-Mullica_Queen-2017	LG09	N/A	60.6	scf6i	View
8	Cranberry-Composite_map-F1	LG09	N/A	38.06	scf6i	View
9	Cranberry-Crimson_Queen-F1	LG09	N/A	27.47	scf6i	View
10	Cranberry-Mullica_Queen_1-F1	LG09	N/A	38.77	scf6i	View
11	Cranberry-Mullica_Queen_2-F1	LG09	N/A	41.61	scf6i	View
12	Cranberry-Stevens-F1	LG09	N/A	25.72	scf6i	View