SCF77145, SCF77145 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF77145
Genbank IDKP278763
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)10
Primer 1SCF77145.forward primer: TAGAATTAGCCTCCAAGAAGTG
Primer 2SCF77145.reverse primer: AGAACTAGAAACACGAGAACGA
Max Length325
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG2N/A98.7SCF77145View
2Cranberry-Crimson_Queen-F1LG02N/A0SCF77145View
3Cranberry-Crimson_Queen-2017LG02N/A92.7SCF77145View
4Cranberry-CNJ02-1-2007LG2N/A105.65SCF77145View
5Cranberry-CNJ02-1-2017LG02N/A101.6SCF77145View
6Cranberry-Composite_map-F1LG02N/A0SCF77145View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278763
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF77145.forward primerVaccinium macrocarponprimer
reverse primerSCF77145.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF77145SCF77145Vaccinium macrocarponmarker_locus