SCF71184, SCF71184 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF71184
Genbank IDKP278754
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(ATT)22
Primer 1SCF71184.forward primer: TCTGTTCAGTTGGGCTTTAT
Primer 2SCF71184.reverse primer: GCTCACATTCACCTGTAATTC
Max Length231
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2017LG08N/A40.9SCF71184View
2Cranberry-CNJ02-1-2007LG8N/A46SCF71184View
3Cranberry-CNJ02-1-2017LG08N/A46SCF71184View
4Cranberry-Crimson_Queen-2007LG8N/A43.4SCF71184View
5Cranberry-Mullica_Queen-2017LG08N/A49.2SCF71184View
6Cranberry-Mullica_Queen-2007LG8N/A48.3SCF71184View
7Cranberry-Composite_map-F1LG08N/A43.47SCF71184View
8Cranberry-Crimson_Queen-F1LG08N/A28.67SCF71184View
9Cranberry-Mullica_Queen_1-F1LG08N/A59.48SCF71184View
10Cranberry-BB/CQ-F1LG04N/A58.16SCF71184View
11Cranberry-BB/CQ-F1LG04N/A41.21SCF71184View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278754
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF71184.forward primerVaccinium macrocarponprimer
reverse primerSCF71184.reverse primerVaccinium macrocarponprimer


This genetic_marker is located in the following QTL feature(s):

Feature NameUnique NameSpeciesType
Titratable acidityqTA.CNJ02-1.LG08Vaccinium macrocarponQTL


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF71184SCF71184Vaccinium macrocarponmarker_locus
SCF71184SCF71184-43.47Vaccinium macrocarponmarker_locus
SCF71184SCF71184-28.67Vaccinium macrocarponmarker_locus
SCF71184SCF71184-59.48Vaccinium macrocarponmarker_locus
SCF71184SCF71184-58.163Vaccinium macrocarponmarker_locus
SCF71184SCF71184-41.211Vaccinium macrocarponmarker_locus