SCF80703, SCF80703 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF80703
Genbank IDKP278770
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AC)17
Primer 1SCF80703.forward primer: GGTCTTTCTCCTAATCTCCAA
Primer 2SCF80703.reverse primer: GGAACCCCTAAATAACATACAG
Max Length220
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Composite_map-F1LG02N/A60.43SCF80703ViewN/A
2Cranberry-Crimson_Queen-F1LG02N/A63.79SCF80703ViewN/A
3Cranberry-Mullica_Queen_1-F1LG02N/A70.05SCF80703ViewN/A
4Cranberry-Mullica_Queen_2-F1LG02N/A73.46SCF80703ViewN/A
5Cranberry-Stevens-F1LG02N/A49.35SCF80703ViewN/A
6Cranberry-Mullica_Queen-2017LG02N/A46.4SCF80703ViewN/A
7Cranberry-Crimson_Queen-2017LG02N/A37.8SCF80703ViewN/A
8Cranberry-CNJ02-1-2017LG02N/A43.6SCF80703ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278770
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF80703.forward primerVaccinium macrocarponprimer
reverse primerSCF80703.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF80703SCF80703-60.43Vaccinium macrocarponmarker_locus
SCF80703SCF80703-63.79Vaccinium macrocarponmarker_locus
SCF80703SCF80703-70.05Vaccinium macrocarponmarker_locus
SCF80703SCF80703-73.46Vaccinium macrocarponmarker_locus
SCF80703SCF80703-49.35Vaccinium macrocarponmarker_locus
SCF80703SCF80703Vaccinium macrocarponmarker_locus