SCF79014, SCF79014 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF79014
Genbank IDKP278767
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)10
Primer 1SCF79014.forward primer: TCTCTGTCTCTGTCTCTGTCTG
Primer 2SCF79014.reverse primer: CCAAATCAAGGTCTGTCTATCT
Max Length183
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG4N/A82SCF79014View
2Cranberry-CNJ02-1-2007LG4N/A75.21SCF79014View
3Cranberry-CNJ02-1-2017LG04N/A76.1SCF79014View
4Cranberry-Crimson_Queen-2007LG4N/A69.9SCF79014View
5Cranberry-Mullica_Queen-2017LG04N/A77.9SCF79014View
6Cranberry-Crimson_Queen-2017LG04N/A42.4SCF79014View
7Cranberry-Composite_map-F1LG04N/A62.26SCF79014View
8Cranberry-Crimson_Queen-F1LG04N/A64.93SCF79014View
9Cranberry-Mullica_Queen_1-F1LG04N/A83.52SCF79014View
10Cranberry-Mullica_Queen_2-F1LG04N/A59.95SCF79014View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278767
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF79014.forward primerVaccinium macrocarponprimer
reverse primerSCF79014.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF79014SCF79014Vaccinium macrocarponmarker_locus
SCF79014SCF79014-62.26Vaccinium macrocarponmarker_locus
SCF79014SCF79014-64.93Vaccinium macrocarponmarker_locus
SCF79014SCF79014-83.52Vaccinium macrocarponmarker_locus
SCF79014SCF79014-59.95Vaccinium macrocarponmarker_locus