SCF72209, SCF72209 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF72209
Genbank ID	KP278755
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(CT)12
Primer 1	SCF72209.forward primer: CTTTACCTTTTCCTTCAGTCGT
Primer 2	SCF72209.reverse primer: GAGGTTCACCAAATCTTACCA
Max Length	210
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278755

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr11	supercontig	Vmac_chr11:2409593..2409772 .
chr11	supercontig	chr11:2258241..2258424 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG11	N/A	3.34	SCF72209	View
2	Cranberry-CNJ02-1-2007	LG11	N/A	2.22	SCF72209	View
3	Cranberry-Crimson_Queen-2007	LG11	N/A	2.2	SCF72209	View
4	Cranberry-Mullica_Queen-2007	LG11	N/A	1.9	SCF72209	View
5	Cranberry-[BG//BL/BN]95-F1	LG11	N/A	0	SCF72209	View
6	Cranberry-Crimson_Queen-F1	LG11	N/A	0	SCF72209	View
7	Cranberry-GH1/35-F1	LG11	N/A	0	SCF72209	View
8	Cranberry-Mullica_Queen_2-F1	LG11	N/A	0	SCF72209	View
9	Cranberry-Stevens-F1	LG11	N/A	0	SCF72209	View
10	Cranberry-CNJ02-1-2017	LG11	N/A	1.5	SCF72209	View
11	Cranberry-Crimson_Queen-2017	LG11	N/A	0.5	SCF72209	View
12	Cranberry-Mullica_Queen-2017	LG11	N/A	0.5	SCF72209	View
13	Cranberry-Composite_map-F1	LG11	N/A	1.19	SCF72209	View
14	Cranberry-Mullica_Queen_1-F1	LG11	N/A	1.19	SCF72209	View