scf79c, scf79c (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf79c
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf79c.forward primer: GGTTCTTCGTGGCATGATAGT
Primer 2	scf79c.reverse primer: CCAAATAACCCAGGAGAGCA
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr12	supercontig	Vmac_chr12:31104241..31104442 .
chr12	supercontig	chr12:29919335..29919532 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1	LG12	N/A	85.37	scf79c	View
2	Cranberry-CNJ02-1-2007	LG12	N/A	19.87	scf79c	View
3	Cranberry-Crimson_Queen-2007	LG12	N/A	17.9	scf79c	View
4	Cranberry-Mullica_Queen-2007	LG12	N/A	25.8	scf79c	View
5	Cranberry-Unifiedmap2013	LG6	N/A	27.4	scf79c	View
6	Blueberry-F1#10_x_W85-23-F1-2017	LG12	N/A	22.1	scf79c	View
7	Blueberry-W85-23-2017	LG12	N/A	18.7	scf79c	View
8	Cranberry-CNJ02-1-2017	LG12	N/A	17.4	scf79c	View
9	Cranberry-Crimson_Queen-2017	LG12	N/A	11	scf79c	View
10	Cranberry-Mullica_Queen-2017	LG12	N/A	22.9	scf79c	View
11	Cranberry-[BG//BL/BN]95-F1	LG12	N/A	74.56	scf79c	View
12	Cranberry-Composite_map-F1	LG12	N/A	66.36	scf79c	View
13	Cranberry-Crimson_Queen-F1	LG12	N/A	51.37	scf79c	View
14	Cranberry-GH1/35-F1	LG12	N/A	67.54	scf79c	View
15	Cranberry-Mullica_Queen_1-F1	LG12	N/A	79.38	scf79c	View
16	Cranberry-BB/CQ-F1	LG06	N/A	25.68	scf79c	View
17	Cranberry-BB/CQ-F1	LG06	N/A	20.41	scf79c	View