SCF73288, SCF73288 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF73288
Genbank IDKP278758
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TC)12
Primer 1SCF73288.forward primer: CAGAGGAACAGCAGACTACAT
Primer 2SCF73288.reverse primer: CCTAGTACGTCATTGGACATTA
Max Length334
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-CNJ02-1-2007LG2N/A65.01SCF73288ViewN/A
2Cranberry-Mullica_Queen-2017LG02N/A64.3SCF73288ViewN/A
3Cranberry-Crimson_Queen-2017LG02N/A53.5SCF73288ViewN/A
4Cranberry-CNJ02-1-2017LG02N/A59.8SCF73288ViewN/A
5Cranberry-Crimson_Queen-2007LG2N/A56.9SCF73288ViewN/A
6Cranberry-Mullica_Queen-2007LG2N/A72.3SCF73288ViewN/A
7Cranberry-Composite_map-F1LG02N/A37.13SCF73288ViewN/A
8Cranberry-Crimson_Queen-F1LG02N/A42.33SCF73288ViewN/A
9Cranberry-Mullica_Queen_1-F1LG02N/A44.89SCF73288ViewN/A
10Cranberry-Mullica_Queen_2-F1LG02N/A49.55SCF73288ViewN/A
11Cranberry-Stevens-F1LG02N/A31.41SCF73288ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278758
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF73288.forward primerVaccinium macrocarponprimer
reverse primerSCF73288.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF73288SCF73288Vaccinium macrocarponmarker_locus
SCF73288SCF73288-37.13Vaccinium macrocarponmarker_locus
SCF73288SCF73288-42.33Vaccinium macrocarponmarker_locus
SCF73288SCF73288-44.89Vaccinium macrocarponmarker_locus
SCF73288SCF73288-49.55Vaccinium macrocarponmarker_locus
SCF73288SCF73288-31.41Vaccinium macrocarponmarker_locus