SCF74458, SCF74458 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF74458
Genbank IDKP278759
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CT)10
Primer 1SCF74458.forward primer: GCAGGAAGCTATGATTAAGGTA
Primer 2SCF74458.reverse primer: TTGAATAGTGTCAGTGGAGAAG
Max Length240
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Crimson_Queen-2007LG2N/A84.5SCF74458View
2Cranberry-Mullica_Queen-2007LG2N/A100.7SCF74458View
3Cranberry-CNJ02-1-2007LG2N/A91.15SCF74458View
4Cranberry-Crimson_Queen-2017LG02N/A79.2SCF74458View
5Cranberry-Mullica_Queen-2017LG02N/A95.8SCF74458View
6Cranberry-CNJ02-1-2017LG02N/A87.4SCF74458View
7Cranberry-Composite_map-F1LG02N/A11.31SCF74458View
8Cranberry-Crimson_Queen-F1LG02N/A19.57SCF74458View
9Cranberry-Mullica_Queen_1-F1LG02N/A16.86SCF74458View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278759
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF74458.forward primerVaccinium macrocarponprimer
reverse primerSCF74458.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF74458SCF74458Vaccinium macrocarponmarker_locus
SCF74458SCF74458-11.31Vaccinium macrocarponmarker_locus
SCF74458SCF74458-19.57Vaccinium macrocarponmarker_locus
SCF74458SCF74458-16.86Vaccinium macrocarponmarker_locus