SCF83872, SCF83872 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF83872
Genbank ID	KP279040
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)10
Primer 1	SCF83872.forward primer: GGAGCTTGAAAACCTAAACA
Primer 2	SCF83872.reverse primer: GTTAGTGAGGAGGGGAGAG
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP279040

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr04	supercontig	Vmac_chr04:8995371..8995711 .
chr4	supercontig	chr4:26730123..26730447 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.