SCF83971, SCF83971 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF83971
Genbank ID	KP278778
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TTG)8
Primer 1	SCF83971.forward primer: ATTCTGGTACTGTTTGTTGCTC
Primer 2	SCF83971.reverse primer: GTTATGTTTCGTGTTCCACTCT
Max Length	347
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278778

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr06	supercontig	Vmac_chr06:37021884..37022199 .
chr6	supercontig	chr6:2653580..2653894 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.