SCF84804, SCF84804 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF84804
Genbank IDKP278779
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CA)13
Primer 1SCF84804.forward primer: CTAGTCTTCTTGTGACCTAGCC
Primer 2SCF84804.reverse primer: TATTCTTTTAGTCCGAGCCA
Max Length213
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen_1-F1LG11N/A0SCF84804View
2Cranberry-CNJ02-1-2017LG11N/A0SCF84804View
3Cranberry-CNJ02-1-2007LG11N/A0SCF84804View
4Cranberry-Mullica_Queen-2017LG11N/A0SCF84804View
5Cranberry-Mullica_Queen-2007LG11N/A0SCF84804View
6Cranberry-Composite_map-F1LG11N/A0SCF84804View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278779
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF84804.forward primerVaccinium macrocarponprimer
reverse primerSCF84804.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF84804SCF84804Vaccinium macrocarponmarker_locus