SCF965, SCF965 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF965
Genbank IDKP278594
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(GA)14
Primer 1SCF965.forward primer: GTAAACTAACAAGCAACGATCC
Primer 2SCF965.reverse primer: GATTTAGCTGATGCAGAGTCAT
Max Length275
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG2N/A90.25SCF965View
2Blueberry-F1#10-2017LG02.1N/A15.9SCF965View
3Cranberry-Crimson_Queen-2007LG2N/A83.1SCF965View
4Cranberry-Crimson_Queen-2017LG02N/A79.2SCF965View
5Cranberry-CNJ02-1-2017LG02N/A87.4SCF965View
6Cranberry-Mullica_Queen-2017LG02N/A95.8SCF965View
7Blueberry-W85-23-2017LG02.1N/A17.5SCF965View
8Cranberry-Mullica_Queen-2007LG2N/A100.3SCF965View
9Blueberry-F1#10_x_W85-23-F1-2017LG02.1N/A17.4SCF965View
10Cranberry-Composite_map-F1LG02N/A11.86SCF965View
11Cranberry-Crimson_Queen-F1LG02N/A20.76SCF965View
12Cranberry-Mullica_Queen_1-F1LG02N/A16.86SCF965View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278594
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF965.forward primerVaccinium macrocarponprimer
reverse primerSCF965.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF965SCF965Vaccinium macrocarponmarker_locus
SCF965SCF965-11.86Vaccinium macrocarponmarker_locus
SCF965SCF965-20.76Vaccinium macrocarponmarker_locus
SCF965SCF965-16.86Vaccinium macrocarponmarker_locus