SCF9709, SCF9709 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF9709
Genbank ID	KP278627
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(AT)9
Primer 1	SCF9709.forward primer: CCATTAGAAGAGTTTACCGTGT
Primer 2	SCF9709.reverse primer: TTATCAGTCCCTTACTCAATCC
Max Length	272
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278627

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr08	supercontig	Vmac_chr08:11766680..11766927 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.