scf8l, scf8l (genetic_marker) Vaccinium macrocarpon

Marker Overview
Genbank IDN/A
SpeciesVaccinium macrocarpon
Repeat Motif(ag)20
Primer 1scf8l.forward primer: CGAATCCGAAGATCAGAAGC
Primer 2scf8l.reverse primer: GGGATACCAGAGATTTCCCG
Max Length172
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerscf8l.forward primerVaccinium macrocarponprimer
reverse primerscf8l.reverse primerVaccinium macrocarponprimer

The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
scf8lscf8lVaccinium macrocarponmarker_locus
scf8lscf8l-94.75Vaccinium macrocarponmarker_locus
scf8lscf8l-63.75Vaccinium macrocarponmarker_locus
scf8lscf8l-80.74Vaccinium macrocarponmarker_locus
scf8lscf8l-109.49Vaccinium macrocarponmarker_locus
scf8lscf8l-12.005Vaccinium macrocarponmarker_locus