SCF97378, SCF97378 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF97378
Genbank IDKP278801
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CA)14
Primer 1SCF97378.forward primer: GTAGAGATCGTTGTCGTCATTT
Primer 2SCF97378.reverse primer: AACATCGTGGTGTATTGGAT
Max Length248
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewerCMap
1Cranberry-Mullica_Queen-2017LG05N/A37.6SCF97378ViewN/A
2Cranberry-CNJ02-1-2007LG5N/A32.84SCF97378ViewN/A
3Cranberry-Mullica_Queen-2007LG5N/A41.7SCF97378ViewN/A
4Cranberry-CNJ02-1-2017LG05N/A31SCF97378ViewN/A
5Cranberry-Composite_map-F1LG05N/A31.09SCF97378ViewN/A
6Cranberry-Mullica_Queen_1-F1LG05N/A36.42SCF97378ViewN/A
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278801
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF97378.forward primerVaccinium macrocarponprimer
reverse primerSCF97378.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF97378SCF97378Vaccinium macrocarponmarker_locus
SCF97378SCF97378-31.09Vaccinium macrocarponmarker_locus
SCF97378SCF97378-36.42Vaccinium macrocarponmarker_locus