SCF98686, SCF98686 (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	SCF98686
Genbank ID	KP278803
Type	SSR
Species	Vaccinium macrocarpon
Repeat Motif	(TC)11
Primer 1	SCF98686.forward primer: CGTAATTTCACATCCTCGTT
Primer 2	SCF98686.reverse primer: CATAACCAGATAGCACCTCAAT
Max Length	253
Publication	[view all]

References

External references for this genetic_marker


Database	Accession
DB:genbank	KP278803

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
Vmac_chr03	supercontig	Vmac_chr03:31470660..31470885 .
chr3	supercontig	chr3:30494086..30494295 .
Chr08	supercontig	Chr08:29930575..29930800 .

Publications


Year	Publication
2015	Schlautman B, Fajardo D, Bougie T, Wiesman E, Polashock J, Vorsa N, Steffan S, Zalapa J. Development and validation of 697 novel polymorphic genomic and EST-SSR markers in the American cranberry (Vaccinium macrocarpon Ait.). Molecules (Basel, Switzerland). 2015; 20(2):2001-13.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG3	N/A	85.12	SCF98686	View
2	Cranberry-Crimson_Queen-2007	LG3	N/A	76.5	SCF98686	View
3	Cranberry-Mullica_Queen-2007	LG3	N/A	95.6	SCF98686	View
4	Cranberry-CNJ02-1-2017	LG03	N/A	79.3	SCF98686	View
5	Cranberry-Crimson_Queen-2017	LG03	N/A	70.6	SCF98686	View
6	Cranberry-Mullica_Queen-2017	LG03	N/A	87.3	SCF98686	View
7	Cranberry-Composite_map-F1	LG03	N/A	17.2	SCF98686	View
8	Cranberry-Crimson_Queen-F1	LG03	N/A	14.9	SCF98686	View
9	Cranberry-Mullica_Queen_1-F1	LG03	N/A	24.51	SCF98686	View
10	Cranberry-Mullica_Queen_2-F1	LG03	N/A	10.49	SCF98686	View
11	Cranberry-Stevens-F1	LG03	N/A	1.49	SCF98686	View