SCF9909, SCF9909 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF9909
Genbank IDKP278630
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(AG)11
Primer 1SCF9909.forward primer: CGTAGGTGGATTTCTCTACAAT
Primer 2SCF9909.reverse primer: GGCATCTTATTTATCGTCTCTG
Max Length173
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2007LG6N/A47.69SCF9909View
2Cranberry-Mullica_Queen-2017LG06N/A49.2SCF9909View
3Cranberry-CNJ02-1-2017LG06N/A42.9SCF9909View
4Cranberry-Crimson_Queen-2007LG6N/A41.8SCF9909View
5Cranberry-Mullica_Queen-2007LG6N/A58.5SCF9909View
6Cranberry-Crimson_Queen-2017LG06N/A36.8SCF9909View
7Cranberry-Composite_map-F1LG06N/A49.79SCF9909View
8Cranberry-Crimson_Queen-F1LG06N/A45.92SCF9909View
9Cranberry-Mullica_Queen_1-F1LG06N/A54.92SCF9909View
10Cranberry-Mullica_Queen_2-F1LG06N/A59.81SCF9909View
11Cranberry-Stevens-F1LG06N/A53.83SCF9909View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278630
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF9909.forward primerVaccinium macrocarponprimer
reverse primerSCF9909.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF9909SCF9909Vaccinium macrocarponmarker_locus
SCF9909SCF9909-49.79Vaccinium macrocarponmarker_locus
SCF9909SCF9909-45.92Vaccinium macrocarponmarker_locus
SCF9909SCF9909-54.92Vaccinium macrocarponmarker_locus
SCF9909SCF9909-59.81Vaccinium macrocarponmarker_locus
SCF9909SCF9909-53.83Vaccinium macrocarponmarker_locus