SCF91821, SCF91821 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF91821
Genbank IDKP278792
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(TG)9
Primer 1SCF91821.forward primer: TTCTGTGTCTGATTCCATCTC
Primer 2SCF91821.reverse primer: ACTAGCCCAACAACTTAGACTG
Max Length304
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-CNJ02-1-2017LG08N/A81.1SCF91821View
2Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG8N/A82.87SCF91821View
3Cranberry-CNJ02-1-2007LG8N/A85.19SCF91821View
4Cranberry-Mullica_Queen-2007LG8N/A99.1SCF91821View
5Cranberry-Mullica_Queen-2017LG08N/A91.8SCF91821View
6Cranberry-Composite_map-F1LG08N/A6.5SCF91821View
7Cranberry-Mullica_Queen_1-F1LG08N/A10.24SCF91821View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278792
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF91821.forward primerVaccinium macrocarponprimer
reverse primerSCF91821.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF91821SCF91821Vaccinium macrocarponmarker_locus
SCF91821SCF91821-6.5Vaccinium macrocarponmarker_locus
SCF91821SCF91821-10.24Vaccinium macrocarponmarker_locus