scf9e, scf9e (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf9e
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf9e.forward primer: TCACAGCGGAGAAGTTGATG
Primer 2	scf9e.reverse primer: ATTTGCGAATCAACCCAAAC
Publication	[view all]

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-CNJ02-1-2007	LG5	N/A	67.28	scf9e	View
2	Cranberry-Crimson_Queen-2007	LG5	N/A	62.7	scf9e	View
3	Cranberry-Mullica_Queen-2007	LG5	N/A	74.1	scf9e	View
4	Cranberry-Unifiedmap2013	LG10	N/A	18.7	scf9e	View
5	Cranberry-CNJ02-1-2017	LG05	N/A	63	scf9e	View
6	Cranberry-Crimson_Queen-2017	LG05	N/A	65.4	scf9e	View
7	Cranberry-Mullica_Queen-2017	LG05	N/A	60.6	scf9e	View
8	Cranberry-Composite_map-F1	LG05	N/A	58.41	scf9e	View
9	Cranberry-Crimson_Queen-F1	LG05	N/A	53.67	scf9e	View
10	Cranberry-GH1/35-F1	LG05	N/A	58.64	scf9e	View
11	Cranberry-Mullica_Queen_1-F1	LG05	N/A	68.62	scf9e	View
12	Cranberry-Mullica_Queen_2-F1	LG05	N/A	57.08	scf9e	View
13	Cranberry-Stevens-F1	LG05	N/A	56.64	scf9e	View
14	Cranberry-BB/CQ-F1	LG10	N/A	70.67	scf9e	View
15	Cranberry-BB/CQ-F1	LG10	N/A	11.38	scf9e	View