SCF92564, SCF92564 (genetic_marker) Vaccinium macrocarpon

Marker Overview
NameSCF92564
Genbank IDKP278794
TypeSSR
SpeciesVaccinium macrocarpon
Repeat Motif(CTT)9
Primer 1SCF92564.forward primer: TCATAACTCCCTCGTAATCAAG
Primer 2SCF92564.reverse primer: AGGAAGAAGAGAATAAGGTTGG
Max Length194
Publication[view all]
Map Positions
#Map NameLinkage GroupBinPositionLocusMapViewer
1Cranberry-Mullica_Queen-2007LG8N/A61.9SCF92564View
2Cranberry-Crimson_Queen-2017LG08N/A53.3SCF92564View
3Cranberry-Mullica_Queen-2017LG08N/A57.9SCF92564View
4Cranberry-[BGx(BLxNL)]95_x_ GH1x35-F1LG8N/A49.09SCF92564View
5Cranberry-Crimson_Queen-2007LG8N/A57.8SCF92564View
6Cranberry-CNJ02-1-2007LG8N/A59.76SCF92564View
7Cranberry-CNJ02-1-2017LG08N/A57.1SCF92564View
8Cranberry-Composite_map-F1LG08N/A28.75SCF92564View
9Cranberry-Crimson_Queen-F1LG08N/A17.26SCF92564View
10Cranberry-Mullica_Queen_1-F1LG08N/A41.99SCF92564View
11Cranberry-Mullica_Queen_2-F1LG08N/A43.69SCF92564View
12Cranberry-Stevens-F1LG08N/A14.99SCF92564View
References
External references for this genetic_marker
DatabaseAccession
DB:genbankKP278794
Relationships

This genetic_marker is adjacent to the following primer feature(s):

Feature NameUnique NameSpeciesType
forward primerSCF92564.forward primerVaccinium macrocarponprimer
reverse primerSCF92564.reverse primerVaccinium macrocarponprimer


The following marker_locus feature(s) are an instance of this genetic_marker:

Feature NameUnique NameSpeciesType
SCF92564SCF92564Vaccinium macrocarponmarker_locus
SCF92564SCF92564-28.75Vaccinium macrocarponmarker_locus
SCF92564SCF92564-17.26Vaccinium macrocarponmarker_locus
SCF92564SCF92564-41.99Vaccinium macrocarponmarker_locus
SCF92564SCF92564-43.69Vaccinium macrocarponmarker_locus
SCF92564SCF92564-14.99Vaccinium macrocarponmarker_locus