scf94a, scf94a (genetic_marker) Vaccinium macrocarpon | GDV

Marker Overview

Marker Overview


Name	scf94a
Genbank ID	N/A
Type	SSR
Species	Vaccinium macrocarpon
Primer 1	scf94a.forward primer: ATGATTTCTTCGGTGCGACT
Primer 2	scf94a.reverse primer: GCATATCTGTCGCCATTGTG
Publication	[view all]

Alignments

The following features are aligned


Aligned Feature	Feature Type	Alignment Location
VaccDscaff38	supercontig	VaccDscaff38:4023348..4023730 .
Vmac_chr11	supercontig	Vmac_chr11:39615203..39615669 .
chr11	supercontig	chr11:37490928..37491388 .

Publications


Year	Publication
2013	Georgi L, Johnson-Cicalese J, Honig J, Das SP, Rajah VD, Bhattacharya D, Bassil N, Rowland LJ, Polashock J, Vorsa N. The first genetic map of the American cranberry: exploration of synteny conservation and quantitative trait loci. TAG. Theoretical and applied genetics. Theoretische und angewandte Genetik. 2013 Mar; 126(3):673-92.

Map Positions


#	Map Name	Linkage Group	Bin	Position	Locus	MapViewer
1	Cranberry-Unifiedmap2013	LG11a	N/A	8.2	scf94a	View
2	Blueberry-F1#10_x_W85-23-F1-2017	LG11	N/A	61.6	scf94a	View
3	Blueberry-F1#10-2017	LG11	N/A	77.8	scf94a	View
4	Blueberry-W85-23-2017	LG11	N/A	29.5	scf94a	View
5	Cranberry-BB/CQ-F1	LG11	N/A	8.56	scf94a	View
6	Cranberry-BB/CQ-F1	LG11	N/A	78.87	scf94a	View