|
Marker Overview
Name | VcMyb10A |
dbSNP ID | N/A |
Type | SNP |
SNP Alleles | N/A |
Species | Vaccinium sp. |
Primer 1 | VcMyb10A.Forward: AATTAGCAGAGGTATGATGA |
Primer 2 | VcMyb10A.Reverse: TCACTCTGATCTTCTTGAAC |
Publication | [view all] |
Contact | Brandon Schlautman
|
Publications
Year | Publication |
2018 | Schlautman B, Diaz-Garcia L, Covarrubias-Pazaran G, Schlautman N, Vorsa N, Polashock J, Ogden E, Brown A, Lin Y, Bassil N, Buck E, Wiedow C, McCallum S, Graham J, Iorizzo M, Rowland L, Zalapa J. Comparative genetic mapping reveals synteny and collinearity between the American cranberry and diploid blueberry genomes. Molecular breeding. 2018; 38(1):9. |
|