rbcL, AF419835.1-rbcL (gene) Vaccinium myrsinites

Gene Overview
NamerbcL
Unique NameAF419835.1-rbcL
Typegene
OrganismVaccinium myrsinites ()
Relationships

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
rbcLrbcLVaccinium myrsinitesgene


The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
rbcLAF419835.1-rbcL.m1Vaccinium myrsinitesmRNA


Alignments
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
AF419835regionAF419835:1..1428 +
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI gene and mRNA sequences2017-01-04
Properties
Property NameValue
Sourcegenbank
Sequences
The following sequences are available for this feature:

gene sequence

>AF419835.1-rbcL ID=AF419835.1-rbcL|Name=rbcL|organism=Vaccinium myrsinites|type=gene|length=1428bp
atgtcaccacaaacagaaactaaagcaagtgttggattcaaagctggtgt
taaagagtacaaattgacttnttatactcctaactatgaaaccaaagata
ctgatatnttggcagcattccgagtaactcntcaaccgggagttccacct
gaagaagcaggggccgcggtagctgcggaatnttttactggtacatggac
atctgtgtggactgatggacttactagccttgatcgttacaaaggtcgat
gctaccacatcgaacccgttcctggagacgaaaatcaatttattgcttat
gtagcttatcctttagacctttttgaagaaggttcagttactaacatgtn
tacttccattgtgggtaatgtttttgggttcaaagccctgcgggctctac
gtctggaagatctacgaatccctgttgcgtntgttaaaactttccaagga
cctcctcacggcatccaagttgaaagagataanttgaacaagtatngtcg
tcccttgttaggatgtactattaaacctaaattggggttatcggctanaa
actatgggagagctgtttatgaatgtctacncggtggacttgattttacg
aaagangatgaanacgtgaactctcnnccatttatgcgttggagagaccg
tttcttattttgtgccgaagcactttttaaagcacaggctgaaaccggtg
aaatcaaagggcattacttgantgctactgcaggtacatgtgaggaaatg
aacaaaagagctgtatttgccanacaattaggagttcctatcgtaatgca
tgactatttaacanggggattcactgcnaatactancttggctgaatatt
gccgagataatggtctacttctgcncatccatcgtgcantgcatgctgtt
nttgatagncnnnngaannntgtcatacattttcgtgtactagctaaagc
gttacgtatgtctggtggagatcatattcacgcgggtactgtagtaggga
aacttgaaggcgaaagagaaatcacgttgggctttgttgatttactgcgt
gatgattatattgaaaaagatcgagcccgcggtatttatttttctcaaga
ttgggtttctctaccaggtgttttgcccgtggcttcaggcggtattcacg
tttggcatatgcctgctctgaccgagatctttggggatgattctgtacta
cagttcggaggaggaactttaggacacccttggggaaatgcgccgggtgc
cgtagctaatcgagtagctctagaagcgtgtgtacaagctcgtaatgagg
gacgtgatcttgctcgtgagggtaatgacattatccgcgaggctactcaa
tggagtaatgaactatctgctgcttgtgcagtatggaangagatcaaatt
tgaattcccagcaatggatactttgtaa
back to top

gene from alignment at AF419835:1..1428+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>AF419835.1-rbcL ID=AF419835.1-rbcL|Name=rbcL|organism=Vaccinium myrsinites|type=gene|length=1428bp|location=Sequence derived from alignment at AF419835:1..1428+ (Vaccinium myrsinites)
atgtcaccacaaacagaaactaaagcaagtgttggattcaaagctggtgt taaagagtacaaattgacttnttatactcctaactatgaaaccaaagata ctgatatnttggcagcattccgagtaactcntcaaccgggagttccacct gaagaagcaggggccgcggtagctgcggaatnttttactggtacatggac atctgtgtggactgatggacttactagccttgatcgttacaaaggtcgat gctaccacatcgaacccgttcctggagacgaaaatcaatttattgcttat gtagcttatcctttagacctttttgaagaaggttcagttactaacatgtn tacttccattgtgggtaatgtttttgggttcaaagccctgcgggctctac gtctggaagatctacgaatccctgttgcgtntgttaaaactttccaagga cctcctcacggcatccaagttgaaagagataanttgaacaagtatngtcg tcccttgttaggatgtactattaaacctaaattggggttatcggctanaa actatgggagagctgtttatgaatgtctacncggtggacttgattttacg aaagangatgaanacgtgaactctcnnccatttatgcgttggagagaccg tttcttattttgtgccgaagcactttttaaagcacaggctgaaaccggtg aaatcaaagggcattacttgantgctactgcaggtacatgtgaggaaatg aacaaaagagctgtatttgccanacaattaggagttcctatcgtaatgca tgactatttaacanggggattcactgcnaatactancttggctgaatatt gccgagataatggtctacttctgcncatccatcgtgcantgcatgctgtt nttgatagncnnnngaannntgtcatacattttcgtgtactagctaaagc gttacgtatgtctggtggagatcatattcacgcgggtactgtagtaggga aacttgaaggcgaaagagaaatcacgttgggctttgttgatttactgcgt gatgattatattgaaaaagatcgagcccgcggtatttatttttctcaaga ttgggtttctctaccaggtgttttgcccgtggcttcaggcggtattcacg tttggcatatgcctgctctgaccgagatctttggggatgattctgtacta cagttcggaggaggaactttaggacacccttggggaaatgcgccgggtgc cgtagctaatcgagtagctctagaagcgtgtgtacaagctcgtaatgagg gacgtgatcttgctcgtgagggtaatgacattatccgcgaggctactcaa tggagtaatgaactatctgctgcttgtgcagtatggaangagatcaaatt tgaattcccagcaatggatactttgtaa
back to top
References
External references for this gene
DatabaseAccession
nuccoreAF419835.1