matK, KJ773217.1-matK (gene) Vaccinium myrsinites

Gene Overview
Unique NameKJ773217.1-matK
OrganismVaccinium myrsinites ()
External references for this gene

This gene is associated with the following gene feature(s):

Feature NameUnique NameSpeciesType
matKmatKVaccinium myrsinitesgene

The following mRNA feature(s) are a part of this gene:

Feature NameUnique NameSpeciesType
matKKJ773217.1-matK.m1Vaccinium myrsinitesmRNA

This gene is derived from or has results from the following analyses
Analysis NameDate Performed
NCBI gene and mRNA sequences2017-01-04
Property NameValue
The following sequences are available for this feature:

gene sequence

>KJ773217.1-matK ID=KJ773217.1-matK|Name=matK|organism=Vaccinium myrsinites|type=gene|length=645bp
back to top

gene from alignment at KJ773217:1..645+

Legend: mRNA
Hold the cursor over a type above to highlight its positions in the sequence below.
>KJ773217.1-matK ID=KJ773217.1-matK|Name=matK|organism=Vaccinium myrsinites|type=gene|length=645bp|location=Sequence derived from alignment at KJ773217:1..645+ (Vaccinium myrsinites)
tcaaaaagaaatcaaaaattcttcttgttcctatataattttcatgtatg tgaatacgaatctatcttcgtttttcttcgcaatcaatcttctcatttat gctcaatatcttttgaaacctttctagaacgaatcttgttctataaaaaa atagaactagaagtctttgttaaggattttaagggcattctatgggtttt caaagaccctttcctgcattatgttagatatcgaggaaaatcaattttgg cttcaaacggttcgtctcttttgatgaataaatggaaatattaccttgtc aatttctgggaatgttatttttccatatgggctcaaccaagaaggatcca tataaaccaattatccaataattccctcgactttctgggctatctttcaa gcgtacgattaaaaccttcaatggtacggagtcaaatgatagaaaattca tttctaatagagaatgctagtaagaagttcgatactctagtgccaattac tccaatgattgcatcattgtctaaagcgaaattttgtaacgtgttaggac atcccatgagtaagtcggtctggagcggtttatcagattctgatattatt gaacgattcgggcgtatatatagaaatctttctcattattatagc
back to top
The following features are aligned
Aligned FeatureFeature TypeAlignment Location
KJ773217regionKJ773217:1..645 +