matK, matK (gene) Vaccinium myrsinites

Gene Overview
Name matK
Gene Symbol matK
Type gene
Organism Vaccinium myrsinites
Synonym maturase K
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
matKKJ773217.1-matKVaccinium myrsinitesgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
matKKJ773217.1-matK.m1Vaccinium myrsinitesmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
KJ773217.1-matK N/A KJ773217.1
KJ773217.1-matK.m1 N/A KJ773217.1

Sequence(s):
>KJ773217.1-matK645
tcaaaaagaaatcaaaaattcttcttgttcctatataattttcatgtatgtgaatacgaatctatcttcgtttttcttcg
caatcaatcttctcatttatgctcaatatcttttgaaacctttctagaacgaatcttgttctataaaaaaatagaactag
aagtctttgttaaggattttaagggcattctatgggttttcaaagaccctttcctgcattatgttagatatcgaggaaaa
tcaattttggcttcaaacggttcgtctcttttgatgaataaatggaaatattaccttgtcaatttctgggaatgttattt
ttccatatgggctcaaccaagaaggatccatataaaccaattatccaataattccctcgactttctgggctatctttcaa
gcgtacgattaaaaccttcaatggtacggagtcaaatgatagaaaattcatttctaatagagaatgctagtaagaagttc
gatactctagtgccaattactccaatgattgcatcattgtctaaagcgaaattttgtaacgtgttaggacatcccatgag
taagtcggtctggagcggtttatcagattctgatattattgaacgattcgggcgtatatatagaaatctttctcattatt
atagc
back to top
>KJ773217.1-matK.m1645
tcaaaaagaaatcaaaaattcttcttgttcctatataattttcatgtatgtgaatacgaatctatcttcgtttttcttcg
caatcaatcttctcatttatgctcaatatcttttgaaacctttctagaacgaatcttgttctataaaaaaatagaactag
aagtctttgttaaggattttaagggcattctatgggttttcaaagaccctttcctgcattatgttagatatcgaggaaaa
tcaattttggcttcaaacggttcgtctcttttgatgaataaatggaaatattaccttgtcaatttctgggaatgttattt
ttccatatgggctcaaccaagaaggatccatataaaccaattatccaataattccctcgactttctgggctatctttcaa
gcgtacgattaaaaccttcaatggtacggagtcaaatgatagaaaattcatttctaatagagaatgctagtaagaagttc
gatactctagtgccaattactccaatgattgcatcattgtctaaagcgaaattttgtaacgtgttaggacatcccatgag
taagtcggtctggagcggtttatcagattctgatattattgaacgattcgggcgtatatatagaaatctttctcattatt
atagc
back to top
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Vaccinium Gene Database2017-01-04