rbcL, rbcL (gene) Vaccinium myrsinites

Gene Overview
Name rbcL
Gene Symbol rbcL
Type gene
Organism Vaccinium myrsinites
Synonym ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit
Description NA
Comment NA
Evidence for the gene structure imported from NCBI
Relationships

The following gene feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rbcLAF419835.1-rbcLVaccinium myrsinitesgene


The following mRNA feature(s) are associated with this gene:

Feature NameUnique NameSpeciesType
rbcLAF419835.1-rbcL.m1Vaccinium myrsinitesmRNA


Associated Genes
Associated Genes/Sequences

The following feature(s) are associated with this gene:

Name Genome Location NCBI Accession
AF419835.1-rbcL N/A AF419835.1
AF419835.1-rbcL.m1 N/A AF419835.1

Sequence(s):
>AF419835.1-rbcL1428
atgtcaccacaaacagaaactaaagcaagtgttggattcaaagctggtgttaaagagtacaaattgacttnttatactcc
taactatgaaaccaaagatactgatatnttggcagcattccgagtaactcntcaaccgggagttccacctgaagaagcag
gggccgcggtagctgcggaatnttttactggtacatggacatctgtgtggactgatggacttactagccttgatcgttac
aaaggtcgatgctaccacatcgaacccgttcctggagacgaaaatcaatttattgcttatgtagcttatcctttagacct
ttttgaagaaggttcagttactaacatgtntacttccattgtgggtaatgtttttgggttcaaagccctgcgggctctac
gtctggaagatctacgaatccctgttgcgtntgttaaaactttccaaggacctcctcacggcatccaagttgaaagagat
aanttgaacaagtatngtcgtcccttgttaggatgtactattaaacctaaattggggttatcggctanaaactatgggag
agctgtttatgaatgtctacncggtggacttgattttacgaaagangatgaanacgtgaactctcnnccatttatgcgtt
ggagagaccgtttcttattttgtgccgaagcactttttaaagcacaggctgaaaccggtgaaatcaaagggcattacttg
antgctactgcaggtacatgtgaggaaatgaacaaaagagctgtatttgccanacaattaggagttcctatcgtaatgca
tgactatttaacanggggattcactgcnaatactancttggctgaatattgccgagataatggtctacttctgcncatcc
atcgtgcantgcatgctgttnttgatagncnnnngaannntgtcatacattttcgtgtactagctaaagcgttacgtatg
tctggtggagatcatattcacgcgggtactgtagtagggaaacttgaaggcgaaagagaaatcacgttgggctttgttga
tttactgcgtgatgattatattgaaaaagatcgagcccgcggtatttatttttctcaagattgggtttctctaccaggtg
ttttgcccgtggcttcaggcggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattctgtacta
cagttcggaggaggaactttaggacacccttggggaaatgcgccgggtgccgtagctaatcgagtagctctagaagcgtg
tgtacaagctcgtaatgagggacgtgatcttgctcgtgagggtaatgacattatccgcgaggctactcaatggagtaatg
aactatctgctgcttgtgcagtatggaangagatcaaatttgaattcccagcaatggatactttgtaa
back to top
>AF419835.1-rbcL.m11428
atgtcaccacaaacagaaactaaagcaagtgttggattcaaagctggtgttaaagagtacaaattgacttnttatactcc
taactatgaaaccaaagatactgatatnttggcagcattccgagtaactcntcaaccgggagttccacctgaagaagcag
gggccgcggtagctgcggaatnttttactggtacatggacatctgtgtggactgatggacttactagccttgatcgttac
aaaggtcgatgctaccacatcgaacccgttcctggagacgaaaatcaatttattgcttatgtagcttatcctttagacct
ttttgaagaaggttcagttactaacatgtntacttccattgtgggtaatgtttttgggttcaaagccctgcgggctctac
gtctggaagatctacgaatccctgttgcgtntgttaaaactttccaaggacctcctcacggcatccaagttgaaagagat
aanttgaacaagtatngtcgtcccttgttaggatgtactattaaacctaaattggggttatcggctanaaactatgggag
agctgtttatgaatgtctacncggtggacttgattttacgaaagangatgaanacgtgaactctcnnccatttatgcgtt
ggagagaccgtttcttattttgtgccgaagcactttttaaagcacaggctgaaaccggtgaaatcaaagggcattacttg
antgctactgcaggtacatgtgaggaaatgaacaaaagagctgtatttgccanacaattaggagttcctatcgtaatgca
tgactatttaacanggggattcactgcnaatactancttggctgaatattgccgagataatggtctacttctgcncatcc
atcgtgcantgcatgctgttnttgatagncnnnngaannntgtcatacattttcgtgtactagctaaagcgttacgtatg
tctggtggagatcatattcacgcgggtactgtagtagggaaacttgaaggcgaaagagaaatcacgttgggctttgttga
tttactgcgtgatgattatattgaaaaagatcgagcccgcggtatttatttttctcaagattgggtttctctaccaggtg
ttttgcccgtggcttcaggcggtattcacgtttggcatatgcctgctctgaccgagatctttggggatgattctgtacta
cagttcggaggaggaactttaggacacccttggggaaatgcgccgggtgccgtagctaatcgagtagctctagaagcgtg
tgtacaagctcgtaatgagggacgtgatcttgctcgtgagggtaatgacattatccgcgaggctactcaatggagtaatg
aactatctgctgcttgtgcagtatggaangagatcaaatttgaattcccagcaatggatactttgtaa
back to top
Analyses
This gene is derived from or has results from the following analyses
Analysis NameDate Performed
Vaccinium Gene Database2017-01-04